https://orcid.org/0000-0001-7159-2857
Figures
Abstract
Secondary hyperparathyroidism (sHPT) is a significant clinical complication of CKD leading to bone abnormalities and cardiovascular disease. Current treatment based on activating the parathyroid calcium-sensing receptor (CaSR) using calcimimetics such as Cinacalcet, aims to decrease plasma PTH levels and inhibit the progression of parathyroid hyperplasia. In the present study, we found significant diurnal rhythmicity of Casr, encoding the Cinacalcet drug target in hyperplastic parathyroid glands (p = 0.006). In rats with sHPT, Cinacalcet treatment timed prior to the acrophase of Casr expression (chronotherapy: Cina1) was compared with the usual timing of treatment early in the active phase (conventional: Cina2). Without Cinacalcet treatment, induction of sHPT resulted in a significant increase in parathyroid proliferation in terms of Ki-67+ cells compared to that of control rats (p = 0.001). Conventional Cinacalcet treatment (Cina2) did not significantly reduce Ki-67 index compared to untreated rats with sHPT (p = 0.09). In contrast, chronotherapy treatment (Cina1) resulted in a marked inhibition of parathyroid proliferation by Ki-67+ cells compared to untreated rats with sHPT (p = 0.0001). We found significantly reduced parathyroid Ki-67 index using chronotherapy compared to conventional timing of Cinacalcet (Cina1 vs. Cina2: 0.92±0.14% vs. 2.46±0.37%, p = 0.006). Transcriptomic analysis showed that the reduced proliferation of Cina1 was associated with downregulation of genes involved in mitotic activity, together with an increased adaptive response of energy metabolism, as evident from upregulated pathways of Oxidative phosphorylation and TCA cycle compared to the untreated uremic group. Conclusively, it is shown that the inhibitory effect of Cinacalcet on parathyroid cell proliferation is markedly impacted by the timing of administration, suggesting a possible benefit of using chronotherapy in Cinacalcet treatment of sHPT.
Citation: Egstrand S, Mace ML, Morevati M, Engelholm LH, Thomsen JS, Brüel A, et al. (2025) Chronotherapy with Cinacalcet has a striking effect on inhibition of parathyroid gland proliferation in rats with secondary hyperparathyroidism. PLoS ONE 20(1): e0316675. https://doi.org/10.1371/journal.pone.0316675
Editor: Andre van Wijnen, University of Vermont College of Medicine, UNITED STATES OF AMERICA
Received: June 28, 2024; Accepted: December 14, 2024; Published: January 6, 2025
Copyright: © 2025 Egstrand et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The RNAseq data presented in this article are available in NCBI's Gene Expression Omnibus (GEO) and can be accessed through GEO Series accession number GSE227079 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE227079).
Funding: Financial support was obtained from The Eva and Henry Fraenkel Foundation, The Augustinus Foundation, The Kirsten and Freddy Johansen Foundation and The Helen & Ejnar Bjoernow Foundation. The μCT scanner was donated by the VELUX Foundation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Living on a planet with a 24 h day-night rhythm, evolutionary pressure has led to the development of molecular circadian clock mechanisms conserved from cyanobacteria to plants and animals. Ambient light is the main entrainment cue to the circadian clock. In mammals information on ambient light is transmitted from light sensitive cells in the retina to the highly specialized master pacemaker located in the hypothalamic suprachiasmatic nucleus. This master clock synchronizes the peripheral circadian clocks running in numerous tissues in which these endogenous clocks regulate an estimated 8–10% of all expressed genes specific to the given cell-type [1, 2]. In the field of chronobiology, time is measured in Zeitgebertime (ZT) denoting hours since light onset. There is a rapidly growing interest in the circadian rhythms in all aspects of human biology and an increasing acknowledgement that the timing of blood sampling and drug administration can have a huge impact on the reported results and pharmaceutical effects, respectively [3]. Chronotherapy is the principle of timing administration of drugs to the diurnal rhythms of the drug target to optimize the treatment effects and reduce side-effects and drug interactions [3].
We have recently shown that an internal circadian clock operates in the parathyroid glands [4]. We found that 6.85% of all genes expressed in the parathyroid glands of the mouse were significantly rhythmic. Furthermore, numerous parathyroid signature genes, including the calcium-sensing receptor gene, Casr, showed significant 24 h rhythmicity, which was abolished upon disturbance of the parathyroid circadian clock in a transgenic mouse model with knockdown of the core circadian clock activator Bmal1 [5].
Proliferation is very limited in the parathyroid gland under normal conditions [6, 7], but increases dramatically in secondary hyperparathyroidism (sHPT) caused by chronic kidney disease (CKD). Clinically, sHPT is associated with low bone density and vascular calcification. sHPT in CKD occurs with a combination of functional and structural changes in the parathyroid glands resulting in increased parathyroid hormone (PTH) biosynthesis and secretion as well as in parathyroid hyperplasia [8].
Cinacalcet is a calcimimetic inducing positive allosteric modulation of the CaSR used once daily when treating advanced sHPT [9]. Cinacalcet has been shown to inhibit parathyroid proliferation in research animals [10] and the EVOLVE trial has shown a decrease in uncontrolled hyperparathyroidism with a reduced need for surgical parathyroidectomy upon Cinacalcet treatment [11]. Moreover, studies have shown that Cinacalcet treatment led to a decrease in parathyroid gland size as evaluated by ultrasonography [12–15]. Orally administrated Cinacalcet exhibits a short time to maximal plasma concentration followed by decline to baseline levels resulting in a relatively brief peak in plasma concentration and a corresponding decreased PTH secretion [16–18].
In the current investigation, it is shown that the gene expression of the target molecule of Cinacalcet, the parathyroid Casr, exhibited marked diurnal variation in rats with sHPT. The expression was increased in the inactive resting period and decreased in the active period. Therefore, we examined whether there was a beneficial effect of adapting the timing of Cinacalcet administration to match the peak expression of the Casr.
Methods
Study design: Casr gene expression over 24 h
A total of 44 male Wistar rats (Charles River, Germany) at 7-weeks of age were acclimatized for two weeks at our facility in a 12-hour light-dark cycle (lights on at 6.00 a.m. local time [= ZT0] and off at 6 p.m. [= ZT12]) and fed a standard diet (0.9% calcium, 0.5% phosphorus, and 1050 IU/kg vitamin D) with ad libitum access to water and food. After acclimatization, CKD was induced by one-step 5/6 nephrectomy [19] and rats were switched to a high phosphorus diet (0.9% calcium, 1.4% phosphorus, and 600 IU/kg vitamin D) for 8 weeks. At 4-hour intervals, 7–8 rats were anesthetized with Pentobarbital (Nycomed-DAK, Denmark), 50 mg/ml, at dose of 1 μl/g rat, and parathyroid glands were harvested by microdissection and immediately frozen in liquid nitrogen. Rats investigated in the dark period were carefully not exposed to blue light by using red light during anesthesia and covering the eyes once anesthetized. Rats were euthanized using a cardiac injection of Pentobarbital (Nycomed-DAK, Denmark), 200 mg/ml, at a dose of 1 ml.
Study design: Cinacalcet chronotherapy
A total of 60 male Wistar rats (Charles River, Germany) at 7-weeks of age were acclimatized for two weeks at our facility in a 12-hour light-dark cycle and fed a standard diet (0.9% calcium, 0.5% phosphorus, and 1050 IU/kg vitamin D) with ad libitum access to water and food. After acclimatization, CKD was induced by one-step 5/6 nephrectomy [19] in 40 rats and the food were switched to a high phosphorus diet (0.9% calcium, 1.4% phosphorus, and 600 IU/kg vitamin D). After four weeks of uremia, 20 CKD rats were assigned to two treatment groups: Cina1 and Cina2 receiving Cinacalcet (STADA Nordic, Herlev, Denmark) at a dose of 2.5 mg once daily by oral gavage at either morning (ZT2, N = 10) or evening (ZT14, N = 10), respectively. This dose was based on previously published studies and a pilot study in rats showing a 30% decrease in PTH levels similar to a common endpoint in clinical studies [20]. The remaining 20 untreated CKD rats were assigned to morning (PNX1, N = 10) or evening (PNX2, N = 10) investigation. Likewise, the 20 normal control rats were assigned to morning (ctrl1, N = 10) or evening (ctrl2, N = 10) investigation. After three weeks of treatment, rats were investigated at the assigned time point, that is, morning (ZT2) for groups: Cina1, PNX1, and ctrl1, and evening (ZT14) for groups: Cina2, PNX2, and ctrl2. For treatment groups, investigation was performed 24 h after last treatment administration. Rats were anesthetized with Pentobarbital (Nycomed-DAK, Denmark), 50 mg/ml, at dose of 1 μl/g rat and blood was drawn from orbital venous plexus. Then the left parathyroid gland was harvested by microdissection and immediately frozen in liquid nitrogen while the right thyroid containing the right parathyroid gland was excised and fixed in 10% formalin. Aorta thoracalis was immediately frozen in liquid nitrogen. The left femoral bone was stripped for soft tissue and stored in 70% EtOH for μCT. Rats were euthanized using a cardiac injection of Pentobarbital (Nycomed-DAK, Denmark), 200 mg/ml, at a dose of 1 ml.
Biochemistry
Blood urea nitrogen (BUN), creatinine, phosphate, and total calcium were analyzed using a Cobas 8000 biochemistry analyzer (Roche Diagnostics, Basel, Switzerland) on plasma samples stored at −20°C and thawed only once. Ionized Ca2+ was analyzed immediately after blood sampling on an ABL90 FLEX gas analyzer (Radiometer, Brønshøj, Denmark). PTH was measured by the rat bioactive PTH ELISA assay (Quidel, San Diego, USA). In our lab, the intra- and inter-assay variations are 4% and 9%, respectively [21]. FGF23 was measured by the intact FGF23 ELISA assay (Kainos Laboratories, Japan). In our lab, the intra-and inter-assay variations were 2.5% and 5%, respectively [22].
Immunohistochemistry
Right thyroparathyroid specimens from were fixed in 10% formalin and embedded in paraffin. Formalin-fixed, paraffin-embedded thyroparathyroid tissue sections were cut in 3.5-μm-thick sections and mounted on aminopropyltriethoxysilane-coated glass slides. Sections were available from 9 ctrl1 rats, 7 ctrl2 rats, 7 PNX1 rats, 7 PNX2 rats, 10 Cina1 rats, and 9 Cina2 rats. Tissue sections were placed in a heating cabinet at 60°C for one hour, and then deparaffinized and rehydrated using Tissue-Tek Tissue Clear (Sakura, Alphen aan den Rijn, The Netherlands) and decreasing concentrations of ethanol, followed by 5 min rinsing in water. The sections were treated with 0.1 mol/L citrate, pH 6.0, in a microwave oven for 10 min for antigen retrieval, followed by blocking of endogenous peroxidase activity with 1% H2O2 for 15 min. Immunostainings were performed using rabbit anti-Ki67 monoclonal Ab (ab16667, Abcam, Cambridge, UK) diluted 1:100 in Background Reducing Antibody Diluent (Agilent, California, USA). Sections were incubated with primary antibodies overnight at 4°C, washed in TBS-T (50 mM Tris, 150 mM NaCl, 0.5% Triton X-100, pH 7.6), and incubated 45 min with EnVision + System HRP Labelled Polymer Anti-Rabbit IgG (Agilent, California, USA). Chromogen staining was performed using the NovaRED HRP substrate kit (VWR, Pennsylvania, USA). Nuclear counterstaining was done with Mayer’s hematoxylin (Histolab, Askim, Sweden). Then sections were dehydrated with increasing concentrations of ethanol and mounted using Tissue-Tek Tissue Mount (Sakura, Alphen aan den Rijn, The Netherlands). Slides were scanned on a Nanozoomer 2.0 HT Digital Pathology slide scanner (Hamamatsu, Shizuoka, Japan).
Quantification
The scanned slides were analyzed using Qupath v.0.2.3 [23]. Region of analysis was delimited by the fibrous capsule of the parathyroid glands excluding adjacent thyroid tissue. Intraparathyroid blood vessels were excluded for analysis. For detection of positive DAB staining, the positive cell detection function was used at default settings except for “Sigma”, which was set at 0.8, “Minimal Nucleus Size”, which was set at 8 μm, and threshold, which was set at 0.4.
Micro-Computed Tomography (μCT)
Left femoral bone was available from 10 ctrl1 rats, 10 ctrl2 rats, 8 PNX1 rats, 7 PNX2 rats, 10 Cina1 rats, and 10 Cina2 rats. The distal metaphysis and mid-diaphysis of the left femora were scanned in a desktop μCT scanner (Scanco μCT 35; Scanco Medical, Brüttiselen, Switzerland). Scans were conducted in high resolution mode (1000 projections/180°) with isotropic voxel size of either 3.5 μm (distal metaphysis) or 6.0 μm (mid-diaphysis), x-ray voltage of 55 kV, current of 145 μA, and an integration time of 800 ms. Beam hardening effects were reduced by using a 0.5 mm aluminum filter. Volumes of interest (VOIs) were drawn semi-automatically using the software provided with the scanner. The femoral metaphyseal VOI was set 200 μm above the distal part of the growth plate and extended 1000 μm further above, thus excluding primary spongiosa and including trabecular bone only. The femoral mid-diaphyseal VOI was set as a 1398-μm-high region centered on the mid-point of the bone shaft, thus containing cortical bone only. The three-dimensional dataset was low-passed-filtered using a Gaussian filter (σ = 0.8, support = 1) and segmented with a fixed threshold filter of 510 HA/cm3. The assessment of the bone microstructure using μCT was performed in accordance with current guidelines [24]. Quality assurance was performed by scans of the solid-state calibration phantom, which were provided with the scanner. The CV of distal femoral metaphyseal bone volume/tissue volume determined with the μCT scanner is 1.8% in our laboratory (the same sample measured 10 times).
Aortic calcium quantification
Ascending aorta was available from 8 ctrl1 rats, 10 ctrl2 rats, 7 PNX1 rats, 7 PNX2 rats, 9 Cina1 rats, and 10 Cina2 rats. To assess the level of blood vessel calcification, calcium content of the ascending aorta was quantified and normalized to tissue dry weight (μg Calcium/mg aorta tissue). Aortic calcium content was determined by the o-cresolphthalein method [22]. Briefly, a section of the aorta was lyophilized for 24 hours to determine dry weight followed by decalcification in 1 M HCl for three days and the calcium content of the supernatant was determined using a commercial calcium colorimetric assay (MAK022-1KT, Sigma-Aldrich, Missouri, USA).
Quantitative RT-PCR
Total RNA was extracted using TRIzol (Sigma-Aldrich, St Louis, MO, USA) according to the manufacturer’s instructions. First-strand cDNA was synthesized from 1.0 μg of RNA with Superscript III cDNA kit (Invitrogen, MA, USA). Jumpstart (Sigma-Aldrich, MO, USA) and Lightcycler 480II (Roche, Basel, Switzerland) were used for qRT-PCR, with a binding temperature of 59°C. The mRNA levels were normalized to reference gene Hprt1 and reference gene stability was confirmed using R Statistical Software with the package ctrlGene [25], which uses the GeNorm algorithm. For the Calcium-Sensing receptor gene, Casr, the primer sequences are: TTCTCCAGAGAGGTGCCTTTCT (forward) and GGCACTCGCATCTGTCTCTCCA (reverse). For the Hypoxanthine phosphoribosyltransferase 1 gene, Hprt1, the primer sequences are: CCCAGCGTCGTGATTAGTGA (forward) and CCAAATCTTCAGCATAATGATTAGGTAT (reverse).
RNA-sequencing and analysis
Next-Generation-Sequencing was performed at Department of Genomic Medicine, Rigshospitalet, Denmark. Total RNA was extracted using TRIzol (Sigma-Aldrich, St Louis, MO, USA) according to the manufacturer’s instructions and purified using Qiagen RNase-Free DNase Set (Qiagen, Hilden, Germany) on a QIAcube Connect (Qiagen, Hilden, Germany). RNA quality was examined using an Agilent Technologies 2100 Bioanalyzer. After quality control samples were available from 8 ctrl1 rats, 4 ctrl2 rats, 7 PNX1 rats, 7 PNX2 rats, 7 Cina1 rats, and 10 Cina2 rats. Library preparation was done using a TruSeq Stranded Total RNA Gold kit with dual adaptor indexing strategy; IDT for Illumina–TruSeq RNA UD Indexes (Illumina, San Diego, USA). The library was diluted and pooled to a concentration of 2 nM according to the procedure of “Denature and Dilute Libraries Guide of Illumina Novaseq 6000” and final loading concentration was 400 pM. Libraries were sequenced paired-end (2 x 151bp) to a sequencing depth of 40 M reads/sample by NovaSeq 6000 with SP Reagent Kit v1.5 (Illumina, San Diego, USA). Loading method was according to “NovaSeq 6000 Sequencing System Guide”. The fastQ data was generated by Novaseq automatically. RNA raw sequence reads were aligned to the reference genome (rn6) using STAR [26] (version 2.7.8a+galaxy0), uniquely mapped reads were counted using featureCounts [27] (version 2.0.1+galaxy1) and genes with less than 10 counts in total were excluded. Counts were then normalized for sequencing depth and RNA composition using the median of ratios method employed in DESeq2 [28] (version 1.30.1). Normalized counts were used for differential expression analysis using DESeq2 and the clusterProfiler [29] package (version 3.18.1) was used for gene ontology enrichment (enrichGO) and gene set enrichment analysis (GSEA) [30] with FDR-adjusted p-value at <0.05.
Statistics
All statistical analyses were performed using the R Statistical Software (version 4.0.4) [31]. The circadian rhythmicity of Casr was analyzed by cosinor regression analysis [32]. For cosinor regression analysis, data were fitted to a linear model using the least squared method minimizing the residual sum of the squares:
ZT = zeitgebertime (h), MESOR = rhythm adjusted mean, β = A∙cos φ, γ = A∙sin φ, A = Amplitude, φ = Acrophase. The period was fixed at 24 h. Significant rhythm was found when the 95% confidence intervals of β or γ did not include “0”.
Welch’s two sample t-test or Mann-Whitney test was used for comparing two groups.
More than two groups were compared by Kruskal Wallis test with post hoc test after Dunn with Bonferroni adjustment. Results were classified as significant at p < 0.05. Values are presented as mean±SEM, except in S1 Table in S1 File presenting values as mean±SD.
Ethics
The study was approved by the Danish Animal Inspectorate (Reference no. 2017-15-0201-01214) and executed in accordance with national guidelines for laboratory animals and in adherence to the NIH Guide for the Care and Use of Laboratory Animals. For the Cinacalcet Chronotherapy protocol, surgery was performed under Pentobarbital anesthesia, and all efforts were made to minimize suffering. Humane endpoints were behavioral signs of distress, reduced intake of food or water, and 20% weight loss. During the first 3 days after surgery, animals were monitored at least 3 times a day. After 3 days, animals are monitored at least once daily and weighted once weekly throughout the protocol. Rats were anesthetized with Pentobarbital (Nycomed-DAK, Denmark), 50 mg/ml, at dose of 1 μl/g rat and euthanized using a cardiac injection of Pentobarbital (Nycomed-DAK, Denmark), 200 mg/ml, at a dose of 1 ml.
Results
Parathyroid gene expression of Casr shows marked circadian rhythmicity in sHPT
Parathyroid gene expression was examined at 4 h interval for 24 h of 44 rats with secondary hyperparathyroidism induced by 5/6 nephrectomy combined with a high phosphate diet. We found a significant circadian rhythmicity of the Casr gene expression (p = 0.006) with a clear decrease in expression during the active dark phase of the nocturnal rats (Fig 1).
Expression profile of Casr gene over 24 h in parathyroid glands from 44 rats with secondary hyperparathyroidism. Rhythmicity was examined by cosinor regression analysis and showed significant 24 h rhythmicity of expression (p = 0.006). Dots represent one sample. Data are fitted by cosinor regression (solid line). Gray areas indicate dark period and white areas indicate light period. Zeitgebertime (ZT; “time-giver”) is hours since light onset. Gene expression was normalized to the expression of housekeeping gene Hprt1.
Chronotherapy–study design and biochemistry
Having found diurnal variation in the expression of Casr, we next examined whether timing of Cinacalcet administration according to this rhythm, would increase the effect of treatment. To this end, we conducted a chronotherapy study using 60 rats as shown in Fig 2. The groups were comparable in weight before 5/6 nephrectomy was performed (Table 1: w0). There was a significant decrease in body weight and an increase in plasma urea, creatinine, and phosphate of the CKD groups compared to control groups four weeks post-nephrectomy (Table 1: w4). There was no significant difference in urea, creatinine, phosphate or calcium between CKD groups immediately before treatment was initiated (Table 1: w4) or after three weeks of Cinacalcet treatment at time of investigation, either ZT2 or ZT14 (Table 1: w7). Plasma PTH and FGF23 were significantly elevated in all CKD groups compared to both control groups with no significant difference between CKD groups before treatment (Table 1: w4). At time of investigation after 7 weeks of uremia, CASR immunostaining was significantly decreased in both untreated CKD groups compared to both control groups (S1 Fig in S1 File). Cinacalcet treatment maintained CASR expression at a similar level in the two treatment groups, with Cina1 showing significant increase compared to both PNX1 and PNX2 and Cina2 showing significant increase compared to PNX2 (S1 Fig in S1 File). In both treatment groups, after three weeks of Cinacalcet treatment there was a significant reduction in FGF23 compared to untreated CKD group (Table 1: w7). Cinacalcet treatment at ZT2 (Cina1) resulted in a 55.1% decrease in PTH and treatment at ZT14 (Cina2) resulted in a 29.0% decrease in PTH compared to the respective untreated CKD control group measured at the same time point which was 24 h since last administration of Cinacalcet. Due to large biological variation, primarily in the untreated CKD groups, these differences did not reach statistical significance (Table 1: w7).
Schematic timeline of the Chronotherapy study. 60 rats were acclimatized for 14 days and, CKD was induced by 5/6 nephrectomy in 40 rats which were shifted to a high-phosphate diet to induce sHPT at w0. Four weeks later at w4, 20 rats with sHPT were randomized to receive Cinacalcet once daily at either ZT2 (N = 10) or ZT14 (N = 10). After three weeks of treatment at w7, Cinacalcet-treated rats were investigated at either ZT2 or ZT14, 24 h since last medication together with untreated normal and sHPT control rats (N = 10 of each). Gray areas indicate dark period and white areas indicate light period. ZT, Zeitgebertime (“time-giver”) is hours since light onset.
Bone micro-CT in CKD
Hyperparathyroid bone disease is a serious complication of sHPT in patients with CKD. μCT of left mid-femur revealed significantly decreased cortical thickness and increased porosity of CKD groups compared to normal control groups, except between Cina1 and ctrl1 (S1 Table and S2A Fig in S1 File). There was no significant difference in mid-diaphyseal cortical porosity between CKD groups. The bone volume fraction of the trabecular bone seemed to be increased in all CKD groups, although this did not reach the level of statistical significance (S1 Table and S2B Fig in S1 File). Within all CKD samples, cortical bone porosity was significantly associated with increasing trabecular bone volume (p<10−6, not shown) and with increasing plasma PTH (p<10−7, S2D Fig in S1 File).
Aortic calcification in CKD
Previous reports have demonstrated protective effect of Cinacalcet treatment on vascular calcification [33]. In the control groups, aortic calcium content was 0.53±0.02 μg/mg (ctrl1) and 0.54±0.03 μg/mg (ctrl2). Vascular calcification was significantly increased in the CKD groups PNX1 (0.81±0.05 μg/mg), PNX2 (0.94±0.11 μg/mg), and Cina1 (0.80±0.06 μg/mg) compared to normal controls, whereas aortic calcification in Cina2 (0.73±0.04 μg/mg) was not significantly elevated compared to normal controls (S2C Fig in S1 File). The aortic calcification did not differ between CKD groups. Thus, the increased aortic calcification in the CKD groups was not significantly attenuated by the Cinacalcet treatment.
Cinacalcet administered early in the inactive phase markedly inhibits proliferation of the parathyroid gland
Parathyroid proliferation was assessed by Ki-67 immunostaining of thyroparathyroid tissue sections obtained at either ZT2 or ZT14, which was 24 h post last treatment for Cinacalcet treated groups and expressed as the fraction of Ki-67 positive cells in the parathyroid gland (Fig 3). There was comparable Ki-67 immunostaining of the parathyroid glands between normal controls at the two time points (ctrl1 vs. ctrl2: n.s.) and also between the untreated CKD control groups at the two time points (PNX1 vs. PNX2: n.s.). The untreated CKD groups had significantly higher Ki-67 labeling index than the control groups (PNX1 vs. ctrl1: p = 0.0007) and (PNX2 vs. ctrl2: p = 0.0012). The percentage of Ki-67 positive cells in the parathyroid glands of all groups across time points are shown in Fig 3A and the Ki-67 staining of the median sample closest to the mean from each group is presented in Fig 3B. We found a strikingly decreased Ki-67 labeling index when Cinacalcet was administered early in the inactive phase at ZT2 (Cina1) as compared to when Cinacalcet was administered early in the active phase at ZT14 (Cina1 vs. Cina2: 0.92±0.14% vs. 2.46±0.37%, p = 0.006) and when compared to the untreated CKD groups at ZT2 (Cina1 vs. PNX1: 0.92±0.14% vs. 3.45±0.47%, p = 0.0002) and at ZT14 (Cina1 vs. PNX2: 0.92±0.14% vs. 4.15±0.47%, p = 0.0001), respectively.
(A) Ki-67 expression in parathyroid glands of rats with CKD-induced sHPT treated with Cinacalcet either early in the inactive light phase (Cina1; N = 10) or early in the active dark phase (Cina2; N = 9) compared to untreated rats with sHPT investigated at similar time points (PNX1; N = 7 and PNX2; N = 7, respective) and to normal rats investigated at similar time points (ctrl1; N = 9 and ctrl2; N = 7, respective). All groups were compared by Kruskal Wallis test with post hoc test after Dunn with Bonferroni adjustment showing significant decreased Ki-67 labeling index of Cina1 compared to Cina2 (p = 0.006) and the untreated CKD groups (p = 0.0001 and p = 0.0002, respectively). (B) For each group, the median Ki-67 immunostained parathyroid sample closest to the group mean is shown. Each dot represents one sample. Scale bars measures 50μm.
RNAseq analysis of the parathyroid glands in sHPT
To investigate the mechanisms behind the marked difference in proliferation derived from timing of Cinacalcet administration, RNAseq was performed on micro-dissected and snap-frozen parathyroid samples from all groups. First, we compared the transcriptome of hyperplastic parathyroid glands in sHPT at either of the two time points: PNX1 and PNX2, to that of normal parathyroid glands harvested at the same time point; ctrl1 and ctrl2, respectively. For both comparisons we found that the transcriptomes of hyperplastic parathyroid glands were well separated from those of normal glands by PCA plot (S3A Fig in S1 File) and that a large percentage of all expressed genes were significantly differentially expressed (26% for PNX1 vs. ctrl1 and 18% for PNX2 vs. ctrl2, Fig 4A). In both cases, gene ontology analysis of the significantly downregulated genes showed significant enrichment in terms of mRNA processing and histone modification (adjusted p-value<0.003, Fig 4B) and these terms were also enriched in the overlapping downregulated genes between the two comparisons (S3C Fig in S1 File). Furthermore, gene ontology analysis of the significantly upregulated genes of both comparisons, PNX1 vs. ctrl1 and PNX2 vs. ctrl2, showed significant enrichment in multiple terms related to ATP synthesis/Oxidative phosphorylation and mitotic nuclear division (adjusted p-value<10−5, Fig 4B) and these terms were also enriched in the overlapping upregulated genes (S3D Fig in S1 File). Non-overlapping differentially expressed genes showed no significant enrichments except for the upregulated genes only in the PNX2 vs. ctrl2 comparison, which were enriched in genes related to fatty acid beta-oxidation (S3D Fig in S1 File).
The transcriptomes of parathyroid glands from untreated CKD groups PNX1 (N = 7) and PNX2 (N = 7) were compared to glands from normal rats investigated at similar time points: ctrl1 (N = 8) and ctrl2 (N = 4), respectively. (A) Comparing PNX1 to ctrl1 14% of all expressed genes were downregulated and 10% upregulated, which was the case for 10% and 8%, respectively, comparing PNX2 to ctrl2. (B) Downregulated genes at both investigated time points were significantly enriched in terms of mRNA processing and histone modification by gene ontology analysis and upregulated genes of both comparisons were enriched in terms related to ATP synthesis/Oxidative phosphorylation and mitotic nuclear division. Dashed line in (A) indicates adjusted p-value of <0.05. For all p-values and further details, please see S2 Table in S1 File.
Gene Set Enrichment Analysis (GSEA) compares two conditions by ranking genes of known pathways by expression, to test for significant up- or downregulation between conditions. GSEA found downregulation of the pathway: mRNA processing (WP529) in both comparisons PNX1 vs. ctrl1 and PNX2 vs. ctrl2 (adjusted p<0.0003, Fig 5A) and GSEA found upregulated pathway of Oxidative phosphorylation (WP1283) in both comparisons (adjusted p-value<10−6), whereas in the PNX2 vs. ctrl2 comparison also pathways of TCA cycle (WP347), Beta-oxidation meta-pathway (WP372), Fatty acid biosynthesis (WP504), Relationship between glutathione and NADPH (WP2562) and Inflammatory response pathway (WP40) were upregulated (adjusted p<0.04) (Fig 5B). For all p-values and schematic overview of significant changes, please see S2 and S3 Tables in S1 File, respectively.
The transcriptomes of parathyroid glands from untreated CKD groups PNX1 (N = 7) and PNX2 (N = 7) were compared to glands from normal rats investigated at similar time points: ctrl1 (N = 8) and ctrl2 (N = 4), respectively. (A) Gene Set Enrichment Analysis (GSEA) found significant downregulation of one pathway: mRNA processing (WP529) and (B) upregulation of the pathway of Oxidative phosphorylation (WP1283) in both comparisons, whereas in the PNX2 vs. ctrl2 comparison also pathways of TCA cycle (WP347), Beta-oxidation meta-pathway (WP372), Fatty acid biosynthesis (WP504), Relationship between glutathione and NADPH (WP2562) and Inflammatory response pathway (WP40) were upregulated. For all normalized enrichment scores (NES), p-values and further details, please see S2 Table in S1 File.
Leading-edge genes are the genes contributing most to the signal in GSEA analysis. Leading-edge genes of the downregulated mRNA processing pathway showed widespread overlap between the two time points and included the majority of Serine/Arginine rich proteins involved in mRNA splicing (S4 Fig in S1 File). Likewise, leading-edge genes of the upregulated Oxidative phosphorylation pathway showed extensive overlap between the two time points and included genes encoding proteins of the mitochondrial respiratory chain complex I converting NADH to NAD+ and genes encoding proteins of the ATP synthase complex converting ADP into ATP (S5 Fig in S1 File).
Taken together, RNAseq analysis of the parathyroid glands in two independent comparisons, morning and evening, showed a concordant decrease in the mRNA processing pathway and an increase in the pathway of mitochondrial Oxidative phosphorylation in sHPT.
RNAseq analysis of parathyroids obtained from rats with sHPT treated with Cinacalcet reveals downregulation of genes involved in proliferation and upregulation of pathways of energy metabolism, but only when Cinacalcet is administered in the morning, Cina1
Transcriptomes of parathyroid samples from the two treatment groups (Cina1 and Cina2) were compared to the corresponding untreated CKD control groups (PNX1 and PNX2, respectively). When comparing the transcriptome of Cina1 to that of PNX1 we found 67 significantly downregulated genes and 23 significantly upregulated genes by differential expression analysis using an adjusted p-value of <0.05. Surprisingly, we found no significantly differentially expressed genes when comparing the transcriptome of Cina2 to that of PNX2 (Fig 6A). Gene ontology analysis of significantly downregulated genes in Cina1 were enriched in multiple terms involved in chromatin organization, mitotic cell cycle checkpoint transition and mitotic nuclear division (Fig 6B). Upregulated genes in Cina1 showed no significant enrichment of gene ontology terms.
The transcriptomes of parathyroid glands from Cinacalcet treated CKD groups Cina1 (N = 7) and Cina2 (N = 10) were compared to glands from untreated CKD rats investigated at similar time points: PNX1 (N = 6) and PNX2 (N = 7), respectively. (A) Comparing Cina1 to PNX1, 67 genes were downregulated and 23 upregulated. No genes were differentially expressed comparing Cina2 to PNX2. (B) The downregulated genes of Cina1 were significantly enriched in multiple terms involved in chromatin organization, mitotic cell cycle checkpoint transition and mitotic nuclear division by gene ontology analysis, whereas upregulated genes showed no significant enriched terms. For all normalized enrichment scores (NES), p-values and further details, please see S2 Table in S1 File.
GSEA found that the two Cinacalcet treated groups, when compared to their respective untreated CKD control groups, exhibited significant downregulation of the exact same pathways involved in the ATM signaling pathway (WP654), p53 pathway (WP655) and G1 to S cell cycle control (WP348) as shown in Fig 7A. In addition, GSEA of Cina1 vs. PNX1 also showed downregulation of the closely associated pathway: p53 signal pathway (WP656). When comparing the leading-edge genes of downregulated pathways from both comparisons, we found large overlaps ranging from 37.5% to 61.1% of all leading-edge genes. GSEA analysis showed no upregulated pathways when comparing Cina2 to PNX2, whereas four pathways were significantly upregulated in comparing Cina1 to PNX1 (Fig 7B). Of these, two pathways were involved in energy metabolism: Oxidative phosphorylation (WP1283) and TCA cycle (WP347), one was involved in mRNA processing (WP529) and one in Prostaglandin synthesis and regulation (WP303). Leading-edge genes of the upregulated mRNA processing pathway in Cina1 compared to PNX1 showed large overlap with leading-edge genes of both comparisons between the PNX groups to ctrl groups in which this same pathway was significantly downregulated (S4 Fig in S1 File). Leading-edge genes of the upregulated Oxidative phosphorylation pathway in Cina1 compared to PNX1 showed substantial overlap with leading-edge genes of both comparisons between the PNX groups to ctrl groups in which this same pathway was also significantly upregulated (S5 Fig in S1 File).
The transcriptomes of parathyroid glands from Cinacalcet treated CKD groups Cina1 (N = 7) and Cina2 (N = 10) were compared to glands from untreated CKD rats investigated at similar time points: PNX1 (N = 6) and PNX2 (N = 7), respectively. (A) Gene Set Enrichment Analysis (GSEA) found in both Cinacalcet treated groups a significant downregulation of the pathways: ATM signaling pathway (WP654), p53 pathway (WP655) and G1 to S cell cycle control (WP348) whereas only Cinacalcet administered in the early inactive phase (Cina1) resulted in significant upregulation of the pathways Oxidative phosphorylation (WP1283) and TCA cycle (WP347), mRNA processing (WP529) and Prostaglandin synthesis and regulation (WP303) (B). For all normalized enrichment scores (NES), p-values and further details, please see S2 Table in S1 File.
Taken together, results of the RNAseq analysis showed Cinacalcet-induced downregulation of genes involved in proliferation and upregulation of energy metabolism pathways, but only when Cinacalcet was administered in the morning, Cina1. Furthermore, Cinacalcet treatment resulted in downregulation of cellular stress pathways at both time points of administration.
Discussion
The present study examined the possible benefit of timing Cinacalcet treatment to the diurnal rhythm of its target; the calcium-sensing receptor. We found that the parathyroid expression of the Casr gene was subjected to diurnal rhythmicity and was downregulated in the active period of the uremic rats. We conducted a treatment study administering Cinacalcet when the expression of Casr is high, early in the inactive period (Cina1), compared to the conventional administration time early in the active period (Cina2). Ki-67 is a widely used and recognized proliferation marker present during all active phases of the cell cycle, but absent in quiescent, non-proliferative cells [34, 35]. Parathyroid proliferation assessed by Ki-67 immunostaining showed a striking reduction in the number of Ki-67+ cells in the Cina1 group, which was significantly lower than that of the Cina2 group and the two untreated uremic groups using a conservative Bonferroni adjustment for multiple group comparison. Remarkably, 9 out of 10 parathyroid samples from the uremic Cina1 group showed a reduction in the Ki-67 labeling index to a level that was below the mean of the two normal control groups (ctrl1 and ctrl2).
It is not possible to directly compare PTH levels of the two Cinacalcet treated groups as PTH exhibits a marked diurnal variation, peaking in the inactive period [4] leading to a falsely elevated level in Cina1 measured at ZT2 compared to Cina2 measured at ZT14. Comparing the two Cina groups to PNX groups investigated at the same time point, it seems that even 24 h after last administration, Cinacalcet timed for the inactive phase led to a greater reduction in PTH compared to the untreated CKD group.
To unravel the mechanism behind the marked effect on parathyroid proliferation by timing of Cinacalcet administration, we investigated the transcriptomes of Cina1 and Cina2 and compared them to that of untreated CKD controls, PNX1 and PNX2, respectively. By GSEA analysis, we found that treatment at both time points led to a significant downregulation of the pathway: G1 to S cell cycle control and of the two related cellular stress pathways: ATM pathway and p53 pathway. Administering Cinacalcet early in the inactive period (Cina1) led to a significant downregulation of 67 genes which were enriched in gene ontology terms of mitotic nuclear division, indicating that Cinacalcet treatment at this administration time point inhibited the increased mitotic activity of parathyroid cells in sHPT.
GSEA analysis showed that the mRNA processing pathway was downregulated in both CKD groups (PNX1 and PNX2) compared to controls (ctrl1 and ctrl2) with large overlaps of leading-edge genes. This pathway was upregulated in Cina1 compared to the time-matched untreated CKD group; PNX1. These results indicate that at this time of administration, Cinacalcet treatment counteracts the decreased mRNA processing of hyperplastic parathyroid glands compared to normal glands.
In sHPT, parathyroid glands greatly increase PTH biosynthesis and secretion, which requires increases in energy metabolism, as evident from the comparisons of PNX groups against ctrl groups, which both showed a marked upregulation of the Oxidative phosphorylation pathway. This adaptive response seemed to be further enhanced by Cinacalcet treatment in Cina1 animals since pathways of Oxidative phosphorylation and TCA cycle was further upregulated comparing this group to the untreated CKD group, PNX1. This is very interesting in the light of our recent publication, which found in transgenic mice, that parathyroid glands with marked downregulation of the Oxidative phosphorylation/Electron transport chain and TCA cycle pathways had an insufficient compensatory PTH response to uremia leading to hypocalcemia and marked increase in Ki-67+ and PCNA+ cells [5]. Collectively, our results point to a pivotal and complex role of sufficient energy metabolism in controlling the proliferation of parathyroid chief cells in sHPT.
Studies in humans and rats have shown that vascular smooth muscle cells express CASR suggesting protective effects of Cinacalcet on vascular calcification through mechanism depending on the CASR [36, 37]. A study using 5/6 nephrectomized rats found significantly reduced von Kossa staining in tunica media in aorta after 12 weeks of Calcimimetic treatment compared to vehicle treatment [36]. In the current study, 3 weeks of Cinacalcet treatment had no protective effect on aortic calcification. We suspect that a longer treatment period may be necessary for a significant effect to manifest on this outcome. Few studies have investigated the effects of cinacalcet treatment on bone parameters. One study in nephrectomized rats found direct actions of calcimimetics on bone cell activity and bone formation rate [38] and this was supported in a post hoc analysis of an observational study [39]. In the EVOLVE trial, Cinacalcet treatment did not reduce bone fractures significantly in the intent-to-treat analysis, whereas a lag censoring analysis revealed a significant reduction in time to first fracture [11]. The current study did not find any significant protective effect of 3 weeks of Cinacalcet treatment in CKD in terms of maintaining cortical bone mass or on other bone microstructural properties as examined by μCT.
Animal studies of sHPT have several limitations in translating to the human setting and it is not known whether similar rhythmic Casr expression is found in parathyroid cells of human patients with sHPT. Moreover, current animal models of sHPT do not induce parathyroid adenoma formation as is most often present at the time of Cinacalcet initiation in human patients with sHPT. Hence, the results of the current investigation will need to be confirmed in a human study. If a beneficial effect can be demonstrated in humans, altering the administration time would be a very easy and cost-efficient adjustment to improve the treatment of sHPT. Based on the results of the current study, such an effect may be truly substantial.
In conclusion, the current study reveals a striking anti-proliferative effect of utilizing the principles of chronotherapy to optimize the administration time of Cinacalcet in a rat model of sHPT. We found significant diurnal rhythmicity of the Casr gene, peaking in the inactive phase, and by timing Cinacalcet treatment to this peak we achieved a marked inhibition of the severely increased parathyroid proliferation in sHPT to a level below the proliferative rate of normal parathyroid cells not subjected to uremia. We found that Cinacalcet downregulated pathways of cell cycle transitioning and cellular stress response at both administration times. However, only when administration of Cinacalcet was timed to the Casr peak did it counteract the downregulated mRNA processing pathways found in sHPT and further upregulated the pathways of energy metabolism, which may be essential to avoid excessive parathyroid proliferation in sHPT. The present results therefore indicate a potential significant benefit of using chronotherapy in the Cinacalcet treatment of sHPT.
References
- 1. Storch KF, Lipan O, Leykin I, Viswanathan N, Davis FC, Wong WH, et al. Extensive and divergent circadian gene expression in liver and heart. Nature. 2002;417(6884):78–83. pmid:11967526
- 2. Rey G, Cesbron F, Rougemont J, Reinke H, Brunner M, Naef F. Genome-wide and phase-specific DNA-binding rhythms of BMAL1 control circadian output functions in mouse liver. PLoS Biol. 2011;9(2):e1000595. pmid:21364973
- 3. Walton JC, Walker WH 2nd, Bumgarner JR, Meléndez-Fernández OH, Liu JA, Hughes HL, et al. Circadian Variation in Efficacy of Medications. Clin Pharmacol Ther. 2021;109(6):1457–88. pmid:33025623
- 4. Egstrand S, Nordholm A, Morevati M, Mace ML, Hassan A, Naveh-Many T, et al. A molecular circadian clock operates in the parathyroid gland and is disturbed in chronic kidney disease associated bone and mineral disorder. Kidney Int. 2020;98(6):1461–75. pmid:32721445
- 5. Egstrand S, Mace ML, Morevati M, Nordholm A, Engelholm LH, Thomsen JS, et al. Hypomorphic expression of parathyroid Bmal1 disrupts the internal parathyroid circadian clock and increases parathyroid cell proliferation in response to uremia. Kidney Int. 2022;101(6):1232–50. pmid:35276205
- 6. Wang Q, Palnitkar S, Parfitt AM. Parathyroid cell proliferation in the rat: effect of age and of phosphate administration and recovery. Endocrinology. 1996;137(11):4558–62. pmid:8895317
- 7. Wang Q, Palnitkar S, Parfitt AM. The basal rate of cell proliferation in normal human parathyroid tissue: implications for the pathogenesis of hyperparathyroidism. Clin Endocrinol (Oxf). 1997;46(3):343–9. pmid:9156045
- 8. Drueke TB. Cell biology of parathyroid gland hyperplasia in chronic renal failure. J Am Soc Nephrol. 2000;11(6):1141–52. pmid:10820180
- 9. KDIGO 2017 Clinical Practice Guideline Update for the Diagnosis, Evaluation, Prevention, and Treatment of Chronic Kidney Disease-Mineral and Bone Disorder (CKD-MBD). Kidney Int Suppl (2011). 2017;7(1):1–59.
- 10. Colloton M, Shatzen E, Miller G, Stehman-Breen C, Wada M, Lacey D, et al. Cinacalcet HCl attenuates parathyroid hyperplasia in a rat model of secondary hyperparathyroidism. Kidney Int. 2005;67(2):467–76. pmid:15673294
- 11. Chertow GM, Block GA, Correa-Rotter R, Drüeke TB, Floege J, Goodman WG, et al. Effect of cinacalcet on cardiovascular disease in patients undergoing dialysis. N Engl J Med. 2012;367(26):2482–94. pmid:23121374
- 12. Komaba H, Nakanishi S, Fujimori A, Tanaka M, Shin J, Shibuya K, et al. Cinacalcet effectively reduces parathyroid hormone secretion and gland volume regardless of pretreatment gland size in patients with secondary hyperparathyroidism. Clin J Am Soc Nephrol. 2010;5(12):2305–14. pmid:20798251
- 13. Meola M, Petrucci I, Barsotti G. Long-term treatment with cinacalcet and conventional therapy reduces parathyroid hyperplasia in severe secondary hyperparathyroidism. Nephrol Dial Transplant. 2009;24(3):982–9. pmid:19181759
- 14. Yamada S, Tokumoto M, Taniguchi M, Toyonaga J, Suehiro T, Eriguchi R, et al. Two Years of Cinacalcet Hydrochloride Treatment Decreased Parathyroid Gland Volume and Serum Parathyroid Hormone Level in Hemodialysis Patients With Advanced Secondary Hyperparathyroidism. Ther Apher Dial. 2015;19(4):367–77. pmid:25851690
- 15. Ichii M, Ishimura E, Okuno S, Chou H, Kato Y, Tsuboniwa N, et al. Decreases in parathyroid gland volume after cinacalcet treatment in hemodialysis patients with secondary hyperparathyroidism. Nephron Clin Pract. 2010;115(3):c195–202. pmid:20413997
- 16. Harris RZ, Padhi D, Marbury TC, Noveck RJ, Salfi M, Sullivan JT. Pharmacokinetics, pharmacodynamics, and safety of cinacalcet hydrochloride in hemodialysis patients at doses up to 200 mg once daily. Am J Kidney Dis. 2004;44(6):1070–6. pmid:15558528
- 17. Bailie GR, Johnson CA. Comparative review of the pharmacokinetics of vitamin D analogues. Semin Dial. 2002;15(5):352–7. pmid:12358640
- 18. Brandi L, Egfjord M, Olgaard K. Pharmacokinetics of 1,25(OH)(2)D(3) and 1alpha(OH)D(3) in normal and uraemic men. Nephrol Dial Transplant. 2002;17(5):829–42. pmid:11981071
- 19. Lewin E, Garfia B, Recio FL, Rodriguez M, Olgaard K. Persistent downregulation of calcium-sensing receptor mRNA in rat parathyroids when severe secondary hyperparathyroidism is reversed by an isogenic kidney transplantation. J Am Soc Nephrol. 2002;13(8):2110–6. pmid:12138143
- 20. Block GA, Bushinsky DA, Cheng S, Cunningham J, Dehmel B, Drueke TB, et al. Effect of Etelcalcetide vs Cinacalcet on Serum Parathyroid Hormone in Patients Receiving Hemodialysis With Secondary Hyperparathyroidism: A Randomized Clinical Trial. Jama. 2017;317(2):156–64. pmid:28097356
- 21. Huan J, Olgaard K, Nielsen LB, Lewin E. Parathyroid hormone 7–84 induces hypocalcemia and inhibits the parathyroid hormone 1–84 secretory response to hypocalcemia in rats with intact parathyroid glands. J Am Soc Nephrol. 2006;17(7):1923–30. pmid:16707565
- 22. Gravesen E, Lerche Mace M, Nordholm A, Hofman-Bang J, Hruska K, Haagen Nielsen C, et al. Exogenous BMP7 in aortae of rats with chronic uremia ameliorates expression of profibrotic genes, but does not reverse established vascular calcification. PloS one. 2018;13(1):e0190820. pmid:29304096
- 23. Bankhead P, Loughrey MB, Fernández JA, Dombrowski Y, McArt DG, Dunne PD, et al. QuPath: Open source software for digital pathology image analysis. Sci Rep. 2017;7(1):16878. pmid:29203879
- 24. Bouxsein ML, Boyd SK, Christiansen BA, Guldberg RE, Jepsen KJ, Müller R. Guidelines for assessment of bone microstructure in rodents using micro-computed tomography. J Bone Miner Res. 2010;25(7):1468–86. pmid:20533309
- 25.
Zhong S. ctrlGene: Assess the Stability of Candidate Housekeeping Genes. R package version 1.0.1. https://CRAN.R-project.org/package=ctrlGene. 2019.
- 26. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(1):15–21. pmid:23104886
- 27. Liao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30(7):923–30. pmid:24227677
- 28. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. pmid:25516281
- 29. Yu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. Omics. 2012;16(5):284–7. pmid:22455463
- 30. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102(43):15545–50. pmid:16199517
- 31.
Team RC. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL https://www.R-project.org/. 2021.
- 32. Cornelissen G. Cosinor-based rhythmometry. Theor Biol Med Model. 2014;11:16. pmid:24725531
- 33. Kawata T, Nagano N, Obi M, Miyata S, Koyama C, Kobayashi N, et al. Cinacalcet suppresses calcification of the aorta and heart in uremic rats. Kidney Int. 2008;74(10):1270–7. pmid:18813289
- 34. Scholzen T, Gerdes J. The Ki-67 protein: from the known and the unknown. J Cell Physiol. 2000;182(3):311–22. pmid:10653597
- 35. Bruno S, Darzynkiewicz Z. Cell cycle dependent expression and stability of the nuclear protein detected by Ki-67 antibody in HL-60 cells. Cell Prolif. 1992;25(1):31–40. pmid:1540682
- 36. Hénaut L, Boudot C, Massy ZA, Lopez-Fernandez I, Dupont S, Mary A, et al. Calcimimetics increase CaSR expression and reduce mineralization in vascular smooth muscle cells: mechanisms of action. Cardiovasc Res. 2014;101(2):256–65. pmid:24217682
- 37. Koleganova N, Piecha G, Ritz E, Schmitt CP, Gross ML. A calcimimetic (R-568), but not calcitriol, prevents vascular remodeling in uremia. Kidney Int. 2009;75(1):60–71. pmid:19092814
- 38. Díaz-Tocados JM, Rodríguez-Ortiz ME, Almadén Y, Pineda C, Martínez-Moreno JM, Herencia C, et al. Calcimimetics maintain bone turnover in uremic rats despite the concomitant decrease in parathyroid hormone concentration. Kidney Int. 2019;95(5):1064–78. pmid:30878213
- 39. Jørgensen HS, Cavalier E, Evenepoel P. Clinical evidence of direct bone effects of cinacalcet. Kidney Int. 2020;98(2):514–5. pmid:32709295